EMBOSS: prettyseq

Program prettyseq

Function

Output sequence with translated ranges

Description

This writes out a nicely formatted display of the sequence with the translation (within specified ranges) displayed beneath it.

Slightly unusually, this application uses the codon usage tables to translate the codons.

Usage

Here is a sample session with prettyseq.


% prettyseq
Input sequence: embl:paamir
Range(s) to translate [1-2167]: 135-1292        
Output file [paamir.prettyseq]:

Command line arguments

   Mandatory qualifiers:
  [-sequence]          sequence   Sequence USA
   -range              range      Range(s) to translate
  [-outfile]           outfile    Output file name

   Optional qualifiers:
   -[no]ruler          bool       Add a ruler
   -[no]plabel         bool       Number translations
   -[no]nlabel         bool       Number DNA sequence

   Advanced qualifiers:
   -cfile              codon      Codon usage file
   -width              integer    Width of screen

Mandatory qualifiers Allowed values Default

[-sequence]
(Parameter 1) Sequence USA Readable sequence Required

-range Range(s) to translate Sequence range Whole sequence

[-outfile]
(Parameter 2) Output file name Output file <sequence>.prettyseq

Optional qualifiers Allowed values Default

-[no]ruler Add a ruler Yes/No Yes

-[no]plabel Number translations Yes/No Yes

-[no]nlabel Number DNA sequence Yes/No Yes

Advanced qualifiers Allowed values Default

-cfile Codon usage file Codon usage file in EMBOSS data path Ehum.cut

-width Width of screen Integer 10 or more 60

Mandatory qualifiers	Allowed values	Default
[-sequence] (Parameter 1)	Sequence USA	Readable sequence	Required
-range	Range(s) to translate	Sequence range	Whole sequence
[-outfile] (Parameter 2)	Output file name	Output file	<sequence>.prettyseq
Optional qualifiers	Allowed values	Default
-[no]ruler	Add a ruler	Yes/No	Yes
-[no]plabel	Number translations	Yes/No	Yes
-[no]nlabel	Number DNA sequence	Yes/No	Yes
Advanced qualifiers	Allowed values	Default
-cfile	Codon usage file	Codon usage file in EMBOSS data path	Ehum.cut
-width	Width of screen	Integer 10 or more	60

Input file format

You can specifiy a file of ranges to extract by giving the '-range' qualifier the value '@' followed by the name of the file containing the ranges. (eg: '-range @myfile').

The format of the range file is:

Comment lines start with '#' in the first column.
Comment lines and blank lines are ignored.
The line may start with white-space.
There are two positive (integer) numbers per line separated by one or more space or TAB characters.
The second number must be greater or equal to the first number.
There can be optional text after the two numbers to annotate the line.
White-space before or after the text is removed.

An example range file is:


# this is my set of ranges
12   23
 4   5       this is like 12-23, but smaller
67   10348   interesting region

Output file format

Here is the output from the example run.


PRETTYSEQ of PAAMIR from 1 to 2167

           ---------|---------|---------|---------|---------|---------|
         1 GGTACCGCTGGCCGAGCATCTGCTCGATCACCACCAGCCGGGCGACGGGAACTGCACGAT 60
                                                                        

           ---------|---------|---------|---------|---------|---------|
        61 CTACCTGGCGAGCCTGGAGCACGAGCGGGTTCGCTTCGTACGGCGCTGAGCGACAGTCAC 120
                                                                        

           ---------|---------|---------|---------|---------|---------|
       121 AGGAGAGGAAACGGatgggatcgcaccaggagcggccgctgatcggcctgctgttctccg 180
         1               M  G  S  H  Q  E  R  P  L  I  G  L  L  F  S  E 16

           ---------|---------|---------|---------|---------|---------|
       181 aaaccggcgtcaccgccgatatcgagcgctcgcacgcgtatggcgcattgctcgcggtcg 240
        17   T  G  V  T  A  D  I  E  R  S  H  A  Y  G  A  L  L  A  V  E 36

           ---------|---------|---------|---------|---------|---------|
       241 agcaactgaaccgcgagggcggcgtcggcggtcgcccgatcgaaacgctgtcccaggacc 300
        37   Q  L  N  R  E  G  G  V  G  G  R  P  I  E  T  L  S  Q  D  P 56

           ---------|---------|---------|---------|---------|---------|
       301 ccggcggcgacccggaccgctatcggctgtgcgccgaggacttcattcgcaaccgggggg 360
        57   G  G  D  P  D  R  Y  R  L  C  A  E  D  F  I  R  N  R  G  V 76

           ---------|---------|---------|---------|---------|---------|
       361 tacggttcctcgtgggctgctacatgtcgcacacgcgcaaggcggtgatgccggtggtcg 420
        77   R  F  L  V  G  C  Y  M  S  H  T  R  K  A  V  M  P  V  V  E 96

           ---------|---------|---------|---------|---------|---------|
       421 agcgcgccgacgcgctgctctgctacccgaccccctacgagggcttcgagtattcgccga 480
        97   R  A  D  A  L  L  C  Y  P  T  P  Y  E  G  F  E  Y  S  P  N 116

           ---------|---------|---------|---------|---------|---------|
       481 acatcgtctacggcggtccggcgccgaaccagaacagtgcgccgctggcggcgtacctga 540
       117   I  V  Y  G  G  P  A  P  N  Q  N  S  A  P  L  A  A  Y  L  I 136

           ---------|---------|---------|---------|---------|---------|
       541 ttcgccactacggcgagcgggtggtgttcatcggctcggactacatctatccgcgggaaa 600
       137   R  H  Y  G  E  R  V  V  F  I  G  S  D  Y  I  Y  P  R  E  S 156

           ---------|---------|---------|---------|---------|---------|
       601 gcaaccatgtgatgcgccacctgtatcgccagcacggcggcacggtgctcgaggaaatct 660
       157   N  H  V  M  R  H  L  Y  R  Q  H  G  G  T  V  L  E  E  I  Y 176

           ---------|---------|---------|---------|---------|---------|
       661 acattccgctgtatccctccgacgacgacttgcagcgcgccgtcgagcgcatctaccagg 720
       177   I  P  L  Y  P  S  D  D  D  L  Q  R  A  V  E  R  I  Y  Q  A 196

           ---------|---------|---------|---------|---------|---------|
       721 cgcgcgccgacgtggtcttctccaccgtggtgggcaccggcaccgccgagctgtatcgcg 780
       197   R  A  D  V  V  F  S  T  V  V  G  T  G  T  A  E  L  Y  R  A 216

           ---------|---------|---------|---------|---------|---------|
       781 ccatcgcccgtcgctacggcgacggcaggcggccgccgatcgccagcctgaccaccagcg 840
       217   I  A  R  R  Y  G  D  G  R  R  P  P  I  A  S  L  T  T  S  E 236

           ---------|---------|---------|---------|---------|---------|
       841 aggcggaggtggcgaagatggagagtgacgtggcagaggggcaggtggtggtcgcgcctt 900
       237   A  E  V  A  K  M  E  S  D  V  A  E  G  Q  V  V  V  A  P  Y 256

           ---------|---------|---------|---------|---------|---------|
       901 acttctccagcatcgatacgcccgccagccgggccttcgtccaggcctgccatggtttct 960
       257   F  S  S  I  D  T  P  A  S  R  A  F  V  Q  A  C  H  G  F  F 276

           ---------|---------|---------|---------|---------|---------|
       961 tcccggagaacgcgaccatcaccgcctgggccgaggcggcctactggcagaccttgttgc 1020
       277   P  E  N  A  T  I  T  A  W  A  E  A  A  Y  W  Q  T  L  L  L 296

           ---------|---------|---------|---------|---------|---------|
      1021 tcggccgcgccgcgcaggccgcaggcaactggcgggtggaagacgtgcagcggcacctgt 1080
       297   G  R  A  A  Q  A  A  G  N  W  R  V  E  D  V  Q  R  H  L  Y 316

           ---------|---------|---------|---------|---------|---------|
      1081 acgacatcgacatcgacgcgccacaggggccggtccgggtggagcgccagaacaaccaca 1140
       317   D  I  D  I  D  A  P  Q  G  P  V  R  V  E  R  Q  N  N  H  S 336

           ---------|---------|---------|---------|---------|---------|
      1141 gccgcctgtcttcgcgcatcgcggaaatcgatgcgcgcggcgtgttccaggtccgctggc 1200
       337   R  L  S  S  R  I  A  E  I  D  A  R  G  V  F  Q  V  R  W  Q 356

           ---------|---------|---------|---------|---------|---------|
      1201 agtcgcccgaaccgattcgccccgacccttatgtcgtcgtgcataacctcgacgactggt 1260
       357   S  P  E  P  I  R  P  D  P  Y  V  V  V  H  N  L  D  D  W  S 376

           ---------|---------|---------|---------|---------|---------|
      1261 ccgccagcatgggcgggggaccgctcccatgaGCGCCAACTCGCTGCTCGGCAGCCTGCG 1320
       377   A  S  M  G  G  G  P  L  P  *                               385

           ---------|---------|---------|---------|---------|---------|
      1321 CGAGTTGCAGGTGCTGGTCCTCAACCCGCCGGGGGAGGTCAGCGACGCCCTGGTCTTGCA 1380
                                                                        


...............

Data files

Notes

References

Warnings

Diagnostic Error Messages

Exit status

Known bugs

Program name	Description
backtranseq	Back translate a protein sequence
cusp	Create a codon usage table
getorf	Finds and extracts open reading frames (ORFs)
plotorf	Plot potential open reading frames
remap	Display a sequence with restriction cut sites, translation etc
showorf	Pretty output of DNA translations
showseq	Display a sequence with features, translation etc
transeq	Translate nucleic acid sequences

Author(s)

This application was written by Alan Bleasby (ableasby@hgmp.mrc.ac.uk)

History

Target users

This program is intended to be used by everyone and everything, from naive users to embedded scripts.