EMBOSS: primersearch

Program primersearch

Function

Searches DNA sequences for matches with primer pairs

Description

primersearch reads in primer pairs from an input file and searches them against sequence(s) specified by the user. Each of the primers in a pair is searched against the sequence and potential amplimers are reported. The user can specify a maximum percent mismatch level; for example, 10% mismatch on a primer of length 20bp means that the program will classify a primer as matching a sequence if 18 of the 20 base pairs matches.

Usage

Here is a sample session with primersearch:


unix% primersearch embl:Z52466
Searches DNA sequences for matches with primer pairs
Primer file: primers
Output file [hsa203yc1.primersearch]: stdout
Allowed percent mismatch [0]: 

Primer name D1S243

Primer name D1S468

Primer name D1S2845

Primer name D1S1608

Primer name D1S2893

Primer name D1S2660
Amplimer 1
        Sequence: HSA203YC1 Z52466 
        H.sapiens (D1S2660) DNA segment containing (CA) repeat; clone AFMa203yc1; single read.
        CACACATGCACATGCAC hits forward strand at 27 with 0 mismatches
        AGTGACACCAGCAGGG hits reverse strand at [103] with 0 mismatches
        Amplimer length: 261 bp

Here we run the same example but allowing 20% mismatch between the primers and the sequence.

unix % primersearch embl:Z52466
Searches DNA sequences for matches with primer pairs
Primer file: primers
Output file [hsa203yc1.primersearch]: stdout
Allowed percent mismatch [0]: 20

Primer name D1S243

Primer name D1S468

Primer name D1S2845

Primer name D1S1608

Primer name D1S2893

Primer name D1S2660
Amplimer 1
        Sequence: HSA203YC1 Z52466 
        H.sapiens (D1S2660) DNA segment containing (CA) repeat; clone AFMa203yc1; single read.
        CACACATGCACATGCAC hits forward strand at 49 with 2 mismatches
        AGTGACACCAGCAGGG hits reverse strand at [103] with 0 mismatches
        Amplimer length: 239 bp
Amplimer 2
        Sequence: HSA203YC1 Z52466 
        H.sapiens (D1S2660) DNA segment containing (CA) repeat; clone AFMa203yc1; single read.
        CACACATGCACATGCAC hits forward strand at 27 with 0 mismatches
        AGTGACACCAGCAGGG hits reverse strand at [103] with 0 mismatches
        Amplimer length: 261 bp

Here is an example of running with a file containing a list of sequences.

curium % primersearch @seqs.list
Searches DNA sequences for matches with primer pairs
Primer file: primers
Output file [hs214yg7.primersearch]: stdout
Allowed percent mismatch [0]: 

Primer name D1S243
Amplimer 1
        Sequence: HS214YG7 Z16979 
        H. sapiens (D1S243) DNA segment containing (CA) repeat; clone AFM214yg7; single read.
        CACACAGGCTCACATGCC hits forward strand at 122 with 0 mismatches
        GCTCCAGCGTCATGGACT hits reverse strand at [36] with 0 mismatches
        Amplimer length: 162 bp

Primer name D1S468
Amplimer 1
        Sequence: HS280WE5 Z23994 
        H. sapiens (D1S468) DNA segment containing (CA) repeat; clone AFM280we5; single read.
        AATTAACCGTTTTGGTCCT hits forward strand at 47 with 0 mismatches
        GCGACACACACTTCCC hits reverse strand at [96] with 0 mismatches
        Amplimer length: 185 bp

Primer name D1S2845
Amplimer 1
        Sequence: HS344WE9 Z51474 
        H.sapiens (D1S2845) DNA segment containing (CA) repeat; clone AFM344we9; single read.
        CCAAAGGGTGCTTCTC hits forward strand at 29 with 0 mismatches
        GTGGCATTCCAACCTC hits reverse strand at [157] with 0 mismatches
        Amplimer length: 201 bp

Primer name D1S1608
Amplimer 1
        Sequence: HS829186 G07829 
        human STS CHLC.GATA49A06.P15262 clone GATA49A06, sequence tagged site.
        GATGGCTTTTGGGGACTATT hits forward strand at 13 with 0 mismatches
        CACTGAGCCAAGTGACACAG hits reverse strand at [92] with 0 mismatches
        Amplimer length: 270 bp

Primer name D1S2893
Amplimer 1
        Sequence: HS123XC3 Z50993 
        H.sapiens (D1S2893) DNA segment containing (CA) repeat; clone AFM123xc3; single read.
        AAAACATCAACTCTCCCCTG hits forward strand at 5 with 0 mismatches
        CTCAAACCCCAATAAGCCTT hits reverse strand at [3] with 0 mismatches
        Amplimer length: 215 bp

Primer name D1S2660
Amplimer 1
        Sequence: HSA203YC1 Z52466 
        H.sapiens (D1S2660) DNA segment containing (CA) repeat; clone AFMa203yc1; single read.
        CACACATGCACATGCAC hits forward strand at 27 with 0 mismatches
        AGTGACACCAGCAGGG hits reverse strand at [103] with 0 mismatches
        Amplimer length: 261 bp

Command line arguments

   Mandatory qualifiers:
  [-sequences]         seqall     Sequence database USA
  [-primers]           infile     Primer file
  [-out]               outfile    Output file name
  [-mismatchpercent]   integer    Allowed percent mismatch

   Optional qualifiers: (none)
   Advanced qualifiers: (none)

Mandatory qualifiers Allowed values Default

[-sequences]
(Parameter 1) Sequence database USA Readable sequence(s) Required

[-primers]
(Parameter 2) Primer file Input file Required

[-out]
(Parameter 3) Output file name Output file <sequence>.primersearch

[-mismatchpercent]
(Parameter 4) Allowed percent mismatch Any integer value 0

Optional qualifiers Allowed values Default

(none)

Advanced qualifiers Allowed values Default

(none)

Mandatory qualifiers	Allowed values	Default
[-sequences] (Parameter 1)	Sequence database USA	Readable sequence(s)	Required
[-primers] (Parameter 2)	Primer file	Input file	Required
[-out] (Parameter 3)	Output file name	Output file	<sequence>.primersearch
[-mismatchpercent] (Parameter 4)	Allowed percent mismatch	Any integer value	0
Optional qualifiers	Allowed values	Default
(none)
Advanced qualifiers	Allowed values	Default
(none)

Input file format

The input primer file used in the example above has the following format:

# This is my primer file
D1S243  cacacaggctcacatgcc      gctccagcgtcatggact
D1S468 aattaaccgttttggtcct     gcgacacacacttccc 
D1S2845 ccaaagggtgcttctc        gtggcattccaacctc
D1S1608 gatggcttttggggactatt    cactgagccaagtgacacag
D1S2893 aaaacatcaactctcccctg    ctcaaaccccaataagcctt
D1S2660 cacacatgcacatgcac       agtgacaccagcaggg

Comments can be inserted provided they are prefaced with "#" Empty files will cause primersearch to note that no primers have been found, and to exit. In this example, seqs.list contains the following sequences:

embl:Z16979
embl:Z23994  
embl:Z51474  
embl:G07829  
embl:Z50993  
embl:Z52466

Output file format

Here is an exmaple of the output file:

Primer name D1S243

Primer name D1S468

Primer name D1S2845

Primer name D1S1608

Primer name D1S2893

Primer name D1S2660
Amplimer 1
        Sequence: HSA203YC1 Z52466 
        H.sapiens (D1S2660) DNA segment containing (CA) repeat; clone AFMa203yc1; single read.
        CACACATGCACATGCAC hits forward strand at 27 with 0 mismatches
        AGTGACACCAGCAGGG hits reverse strand at [103] with 0 mismatches
        Amplimer length: 261 bp

Data files

Notes

Every potential amplimer will be reported; if one primer matches the forward strand twice and the other matches the reverse strand only once, two potential amplimers are reported. If the reverse primer matches twice, four potential amplimers are reported. Each primer pair consists of a name, followed by two primer sequences, primerA and primerB. The program first compares primerA to the forward strand and if it matches, primerB is compared to the reverse strand. The approach is then reversed, with the primerB being compared to the forward strand and primerA to the reverse. In this way all possible amplimers are reported.

References

Warnings

Diagnostic Error Messages

"No suitable primers found - exiting" means that either the primers file was empty or there were no compilable primer pairs contained in it.

Exit status

It always exits with status 0

Known bugs

Program name	Description
diffseq	Find differences (SNPs) between nearly identical sequences
dotpath	Displays a non-overlapping wordmatch dotplot of two sequences
dottup	Displays a wordmatch dotplot of two sequences
prima	Selects primers for PCR and DNA amplification
stssearch	Searches a DNA database for matches with a set of STS primers

Author(s)

This application was written by Val Curwen (vcurwen@hgmp.mrc.ac.uk)

History

Target users

This program is intended to be used by everyone and everything, from naive users to embedded scripts.