EMBOSS: remap


Program remap

Function

Display a sequence with restriction cut sites, translation etc

Description

The Restriction Enzyme database (REBASE) is a collection of information about restriction enzymes and related proteins. It contains published and unpublished references, recognition and cleavage sites, isoschizomers, commercial availability, methylation sensitivity, crystal and sequence data. DNA methyltransferases, homing endonucleases, nicking enzymes, specificity subunits and control proteins are also included. Most recently, putative DNA methyltransferases and restriction enzymes, as predicted from analysis of genomic sequences, are also listed.

The home page of REBASE is: http://rebase.neb.com/rebase/rebase.html

This program uses REBASE data to find the recognition sites and/or cut sites of restriction enzymes in a nucleic acid sequence.

This program displays the cut sites on both strands by default. It will optionally also display the translation of the sequence.

There are many options to change the style of display to aid in making clear presentations.

One potentially very useful option is '-flatreformat' that displays not only the cut sites which many other restriction cut-site programs will show, but also shows the recognition site.

Usage

Here is a sample session with remap. We only look at a small section of the sequence to save space.

% remap -notran -sbeg 1 -send 60
Display a sequence with restriction cut sites, translation etc..
Input sequence(s): embl:eclac
Output file [eclac.remap]: 
Comma separated enzyme list [all]: taqi,bsu6i,acii,bsski
Minimum recognition site length [4]: 

Command line arguments

   Mandatory qualifiers:
  [-sequence]          seqall     Sequence database USA
  [-outfile]           outfile    If you enter the name of a file here then
                                  this program will write the sequence details
                                  into that file.
   -enzymes            string     The name 'all' reads in all enzyme names
                                  from the REBASE database. You can specify
                                  enzymes by giving their names with commas
                                  between then, such as:
                                  'HincII,hinfI,ppiI,hindiii'.
                                  The case of the names is not important. You
                                  can specify a file of enzyme names to read
                                  in by giving the name of the file holding
                                  the enzyme names with a '@' character in
                                  front of it, for example, '@enz.list'.
                                  Blank lines and lines starting with a hash
                                  character or '!' are ignored and all other
                                  lines are concatenated together with a comma
                                  character ',' and then treated as the list
                                  of enzymes to search for.
                                  An example of a file of enzyme names is:
                                  ! my enzymes
                                  HincII, ppiII
                                  ! other enzymes
                                  hindiii
                                  HinfI
                                  PpiI
   -sitelen            integer    Minimum recognition site length

   Optional qualifiers:
   -[no]cutlist        bool       List the enzymes that cut
   -flatreformat       bool       Display RE sites in flat format
   -mincuts            integer    Minimum cuts per RE
   -maxcuts            integer    Maximum cuts per RE
   -single             bool       Force single site only cuts
   -[no]blunt          bool       Allow blunt end cutters
   -[no]sticky         bool       Allow sticky end cutters
   -[no]ambiguity      bool       Allow ambiguous matches
   -plasmid            bool       Allow circular DNA
   -[no]commercial     bool       Only enzymes with suppliers
   -[no]limit          bool       Limits reports to one isoschizomer
   -preferred          bool       Report preferred isoschizomers

   Advanced qualifiers:
   -[no]translation    bool       Display translation
   -[no]reverse        bool       Display cut sites and translation of reverse
                                  sense
   -orfminsize         integer    Minimum size of Open Reading Frames (ORFs)
                                  to display in the translations.
   -uppercase          range      Regions to put in uppercase.
                                  If this is left blank, then the sequence
                                  case is left alone.
                                  A set of regions is specified by a set of
                                  pairs of positions.
                                  The positions are integers.
                                  They are separated by any non-digit,
                                  non-alpha character.
                                  Examples of region specifications are:
                                  24-45, 56-78
                                  1:45, 67=99;765..888
                                  1,5,8,10,23,45,57,99
   -highlight          range      Regions to colour if formatting for HTML.
                                  If this is left blank, then the sequence is
                                  left alone.
                                  A set of regions is specified by a set of
                                  pairs of positions.
                                  The positions are integers.
                                  They are followed by any valid HTML font
                                  colour.
                                  Examples of region specifications are:
                                  24-45 blue 56-78 orange
                                  1-100 green 120-156 red
                                  A file of ranges to colour (one range per
                                  line) can be specifed as '@filename'.
   -table              list       Translation table genetic code to use
   -threeletter        bool       Display protein sequences in three-letter
                                  code
   -number             bool       Number the sequences
   -width              integer    Width of sequence to display
   -length             integer    Line length of page (0 for indefinite)
   -margin             integer    Margin around sequence for numbering
   -[no]name           bool       Set this to be false if you do not wish to
                                  display the ID name of the sequence
   -[no]description    bool       Set this to be false if you do not wish to
                                  display the description of the sequence
   -offset             integer    Offset to start numbering the sequence from
   -html               bool       Use HTML formatting


Mandatory qualifiers Allowed values Default
[-sequence]
(Parameter 1)
Sequence database USA Readable sequence(s) Required
[-outfile]
(Parameter 2)
If you enter the name of a file here then this program will write the sequence details into that file. Output file <sequence>.remap
-enzymes The name 'all' reads in all enzyme names from the REBASE database. You can specify enzymes by giving their names with commas between then, such as: 'HincII,hinfI,ppiI,hindiii'. The case of the names is not important. You can specify a file of enzyme names to read in by giving the name of the file holding the enzyme names with a '@' character in front of it, for example, '@enz.list'. Blank lines and lines starting with a hash character or '!' are ignored and all other lines are concatenated together with a comma character ',' and then treated as the list of enzymes to search for. An example of a file of enzyme names is: ! my enzymes HincII, ppiII ! other enzymes hindiii HinfI PpiI Any string is accepted all
-sitelen Minimum recognition site length Integer from 2 to 20 4
Optional qualifiers Allowed values Default
-[no]cutlist List the enzymes that cut Yes/No Yes
-flatreformat Display RE sites in flat format Yes/No No
-mincuts Minimum cuts per RE Integer from 1 to 1000 1
-maxcuts Maximum cuts per RE Integer up to 2000000000 2000000000
-single Force single site only cuts Yes/No No
-[no]blunt Allow blunt end cutters Yes/No Yes
-[no]sticky Allow sticky end cutters Yes/No Yes
-[no]ambiguity Allow ambiguous matches Yes/No Yes
-plasmid Allow circular DNA Yes/No No
-[no]commercial Only enzymes with suppliers Yes/No Yes
-[no]limit Limits reports to one isoschizomer Yes/No Yes
-preferred Report preferred isoschizomers Yes/No No
Advanced qualifiers Allowed values Default
-[no]translation Display translation Yes/No Yes
-[no]reverse Display cut sites and translation of reverse sense Yes/No Yes
-orfminsize Minimum size of Open Reading Frames (ORFs) to display in the translations. Integer 0 or more 0
-uppercase Regions to put in uppercase. If this is left blank, then the sequence case is left alone. A set of regions is specified by a set of pairs of positions. The positions are integers. They are separated by any non-digit, non-alpha character. Examples of region specifications are: 24-45, 56-78 1:45, 67=99;765..888 1,5,8,10,23,45,57,99 Sequence range If this is left blank, then the sequence case is left alone.
-highlight Regions to colour if formatting for HTML. If this is left blank, then the sequence is left alone. A set of regions is specified by a set of pairs of positions. The positions are integers. They are followed by any valid HTML font colour. Examples of region specifications are: 24-45 blue 56-78 orange 1-100 green 120-156 red A file of ranges to colour (one range per line) can be specifed as '@filename'. Sequence range full sequence
-table Translation table genetic code to use
0 (Standard)
1 (Standard (with alternative initiation codons))
2 (Vertebrate Mitochondrial)
3 (Yeast Mitochondrial)
4 (Mold, Protozoan, Coelenterate Mitochondrial and Mycoplasma/Spiroplasma)
5 (Invertebrate Mitochondrial)
6 (Ciliate Macronuclear and Dasycladacean)
9 (Echinoderm Mitochondrial)
10 (Euplotid Nuclear)
11 (Bacterial)
12 (Alternative Yeast Nuclear)
13 (Ascidian Mitochondrial)
14 (Flatworm Mitochondrial)
15 (Blepharisma Macronuclear)
0
-threeletter Display protein sequences in three-letter code Yes/No No
-number Number the sequences Yes/No No
-width Width of sequence to display Integer 1 or more 60
-length Line length of page (0 for indefinite) Integer 0 or more 0
-margin Margin around sequence for numbering Integer 0 or more 10
-[no]name Set this to be false if you do not wish to display the ID name of the sequence Yes/No Yes
-[no]description Set this to be false if you do not wish to display the description of the sequence Yes/No Yes
-offset Offset to start numbering the sequence from Any integer value 1
-html Use HTML formatting Yes/No No

Input file format

You can specifiy a file of ranges to display in uppercase by giving the '-uppercase' qualifier the value '@' followed by the name of the file containing the ranges. (eg: '-upper @myfile').

The format of the range file is:

An example range file is:


# this is my set of ranges
12   23
 4   5       this is like 12-23, but smaller
67   10348   interesting region

You can specifiy a file of ranges to highlight in a different colour when outputting in HTML format (using the '-html' qualifier) by giving the '-highlight' qualifier the value '@' followed by the name of the file containing the ranges. (eg: '-highlight @myfile').

The format of this file is very similar to the format of the above uppercase range file, except that the text after the start and end positions is used as the HTML colour name. This colour name is used 'as is' when specifying the colour in HTML in a '<FONT COLOR=xxx>' construct, (where 'xxx' is the name of the colour).

The standard names of HTML font colours are given in: http://www.iconbazaar.com/color_tables/named_colors.html

An example highlight range file is:


# this is my set of ranges
12   23		red
 4   5		darkturquoise
67   10348	#FFE4E1

Output file format

The output file from the example above follows:

ECLAC
E.coli lactose operon with lacI, lacZ, lacY and lacA genes.

                                                      Hin6I
                                                      | Bsu6I
                 TaqI   Hin6I         AciI            | BssKI 
                 \      \             \               \ \
          GACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAAGAGAGT
                   10        20        30        40        50        60        
          ----:----|----:----|----:----|----:----|----:----|----:----|
          CTGTGGTAGCTTACCGCGTTTTGGAAAGCGCCATACCGTACTATCGCGGGCCTTCTCTCA
                   /      /             /               /  / /
                   TaqI   Hin6I         AciI            |  | BssKI
                                                        |  Bsu6I
                                                        Hin6I

          D  T  I  E  W  R  K  T  F  R  G  M  A  *  *  R  P  E  E  S  
           T  P  S  N  G  A  K  P  F  A  V  W  H  D  S  A  R  K  R  V 
            H  H  R  M  A  Q  N  L  S  R  Y  G  M  I  A  P  G  R  E  S
          ----:----|----:----|----:----|----:----|----:----|----:----|
            V  G  D  F  P  A  F  G  K  A  T  H  C  S  L  A  R  F  L  T
           S  V  M  S  H  R  L  V  K  R  P  I  A  H  Y  R  G  S  S  L 
          X  C  W  R  I  A  C  F  R  E  R  Y  P  M  I  A  G  P  L  S  


Enzymes that cut

      AciI  1
     BssKI  1
     Bsu6I  1
     Hin6I  2
      TaqI  1

The name of the sequence is displayed, followed by the description of the sequence.

The formatted display of cut sites on the sequence follows, with the six-frame translation below it. The cut sites are indicated by a slash character '\' that points to the poition between the nucleotides where the cuts occur. Cuts by many enzymes at the same position are indicated by stacking the enzyme names on top of each other.

At the end the section header 'Enzymes that cut' is displayed followed by a list of the enzymes that cut the specified sequence and the number of times that they cut.

The '-flatreformat' qualifier changes the display to emphasise the recognition site of the restriction enzyme, which is indicated by a row of '=' characters. The cut site if pointed to by a '>' or '<' character and if the cut site is not within or imemdiately adjacent to the recognition site, they are linked by a row or '.' characters.

The name of the enzyme is displayed above (or below when the reverse sense site if displayed) the recognition site. The name of the enzyme is also displayed above the cut site if this occurs on a different display line to the recognition site (i.e. if it wraps onto the next line of sequence).

An example of this display follows with the translation turned off to save space:


% remap embl:eclac stdout -enz taqi,bsu6i,acii,hin6i,bsski -site 4
-sbeg 1 -send 60 -flat -notran
Display a sequence with restriction cut sites, translation etc..

ECLAC
E.coli lactose operon with lacI, lacZ, lacY and lacA genes.

                                                                  Bsu6I
                                                        >.........====
                                                         BssKI
                                                        >=====
                 TaqI   Hin6I            AciI         Hin6I
                 >===   >===          >..====         >===
          GACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAAGAGAGT
                   10        20        30        40        50        60        
          ----:----|----:----|----:----|----:----|----:----|----:----|
          CTGTGGTAGCTTACCGCGTTTTGGAAAGCGCCATACCGTACTATCGCGGGCCTTCTCTCA
                 ===<   ===<             <===         ===<
                 TaqI   Hin6I            AciI         Hin6I
                                                         =====<
                                                         BssKI
                                                            <.....====
                                                                  Bsu6I


Enzymes that cut

      AciI  1
     BssKI  1
     Bsu6I  1
     Hin6I  2
      TaqI  1

Data files

This uses the EMBOSS REBASE data files in 'data/REBASE/*' under the EMBOSS installation directory.

These files must first be set up using the program 'rebaseextract'. Running 'rebaseextract' may be the job of your system manager.

Notes

References

Warnings

Diagnostic Error Messages

Exit status

Known bugs

See also

Program nameDescription
backtranseqBack translate a protein sequence
cuspCreate a codon usage table
getorfFinds and extracts open reading frames (ORFs)
plotorfPlot potential open reading frames
prettyseqOutput sequence with translated ranges
rebaseextractExtract data from REBASE
redataSearch REBASE for enzyme name, references, suppliers etc
restrictFinds restriction enzyme cleavage sites
seqretReads and writes (returns) sequences
seqretallReads and writes (returns) a set of sequences one at a time
seqretsetReads and writes (returns) a set of sequences all at once
seqretsplitReads and writes (returns) sequences
showfeatShow features of a sequence
showorfPretty output of DNA translations
showseqDisplay a sequence with features, translation etc
silentSilent mutation RE scan
transeqTranslate nucleic acid sequences

Author(s)

This application was written by Gary Williams (gwilliam@hgmp.mrc.ac.uk)

History

Target users

This program is intended to be used by everyone and everything, from naive users to embedded scripts.

Comments