|
|
EMBOSS: seqret |
Because EMBOSS programs can take a wide range of qualifiers that slightly change the behaviour of the program when reading or writing a sequence, this program can do many more things than simply "read and write a sequence".
seqret can read a sequence or many sequences from databases, files, files of sequence names, the command-line or the output of other programs and then can write them to files, the screen or pass them to other programs. Because it can read in a sequence from a database and write it to a file, seqret is a program for extracting sequences from databases. Because it can write the sequence to the screen, seqret is a program for displaying sequences.
seqret can read sequences in any of a wide range of standard sequence formats. You can specify the input and output formats being used. If you don't specify the input format, seqret will try a set of possible formats until it reads it in successfully. Because you can specify the output sequence format, seqret is a program to reformat a sequence.
seqret can read in the reverse complement of a nucleic acid sequence. It therefore is a program for producing the reverse complement of a sequence.
seqret can read in a sequence whose begin and end positions you have specified and write out that fragment. It is therefore a utility for doing simple extraction of a region of a sequence.
seqret can change the case of the sequence being read in to upper or to lower case. It is therefore a simple sequence beautification utility.
seqret can do any combination of the above functions.
The sequence input and output specification of this (and many other EMBOSS programs) is described as being a Uniform Sequence Address.
The Uniform Sequence Address, or USA, is a somewhat tongue-in-cheek reference to a URL-style sequence naming used by all EMBOSS applications.
The USA is a very flexible way of specifying one or more sequences from a variety of sources and includes sequence files, database queries and external applications.
The basic USA syntax is one of:
Note that ':' separates the name of a file containing many possible entries from the specific name of a sequence entry in that file. It also separates the name of a database from an entry in that database
Note also that '::' separates the specified format of a file from the name of the file. Normally the format can be omitted, in which case the program will attempt to identify the correct format when reading the sequence in and will default to using FASTA format when writing the sequence out.
Valid names of the databases set up in your local implementation of EMBOSS can be seen by using the program 'showdb'.
Database queries, and individual entries in files that have more than one sequence entry, use wildcards of "?" for any character and "*" for any string of characters. There are some problems with the Unix shell catching these characters so they do need to be hidden in quotes or preceded by a backslash on the Unix command line, (for example "embl:hs\*")
The output USA name 'stdout' is special. It makes the output go to the device 'standard output'. This is the screen, by default.
The following are valid USAs for sequences:
| USA | Description |
|---|---|
| xxx.seq | A sequence file "xxx.seq" in any format |
| fasta::xxx.seq | A sequence file "xxx.seq" in fasta format |
| gcg::egmsmg.gcg | A sequence file "egmsmg.gcg" in GCG 9 format |
| egmsmg.gcg -sformat=gcg | A sequence file "egmsmg.gcg" in GCG 9 format |
| embl::paamir.em | A sequence file "paamir.em" in EMBL format |
| embl:paamir | EMBL entry PAAMIR, using whatever access method is defined locally for the EMBL database |
| embl:X13776 | EMBL entry X13776, using whatever access method is defined locally for the EMBL database and searching by accession number and entry name (X13776 is the accession number in this case) |
| embl-acc:X13776 | EMBL entry X13776, using whatever access method is defined locally for the EMBL database and searching by accession number only |
| embl-id:paamir | EMBL entry PAAMIR, using whatever access method is defined locally for the EMBL database, and searching by ID only |
| embl:paami* | EMBL entries PAAMIB, PAAMIE and so on, usually in alphabetical order, using whatever access method is defined locally for the EMBL database |
| embl or EMBL:* | All sequences in the EMBL database |
| @mylist | Reads file mylist and uses each line as a separate USA. This is standard VMS list file syntax, also used in SRS 4.0 but missing in SRS 5.0. List files can contain references to other lists files or any other standard USA. |
| list::mylist | Same as "@mylist" above |
| 'getz -e [embl-id:paamir] |' | The pipe character "|" causes EMBOSS to fire up getz (SRS 5.1) to extract entry PAAMIR from EMBL in EMBL format. Any application or script which writes one or more sequences to stdout can be used in this way. |
| asis::atacgcagttatctgaccat | So far the shortest USA we could invent. In 'asis' format the name is the sequence so no file needs to be opened. This is a special case. It was intended as a joke, but could be quite useful for generating command lines. |
The valid input sequence formats that are available in USAs are:
| Input Format | Comments |
|---|---|
| fasta pearson ncbi | FASTA format with an optional accession number after the sequence identifier, and with an optional database name in NCBI or GCG style fasta format included as part of the sequence identifier. These are defined as separate formats for output. |
| gcg | GCG 9.x format with the format and sequence type identified on the first line of the file |
| gcg8 | GCG 8.x format where anything up to the first line containing ".." is considered as heading, and the remainder is sequence data. This format is complicated by the header appearing to be in other formats such as EMBL, and by the possibility of reading a large amount of data in the wrong format before discovering that there is no ".." line because it is not GCG format after all. |
| embl | EMBL entry format, or at least a minimal subset of the fields. The Staden package and others use EMBL or similar formats for sequence data. |
| swiss | SWISSPROT entry format, or at least a minimal subset of the fields. |
| genbank | GENBANK entry format, or at least a minimal subset of the fields. |
| ig | IntelliGenetics format. |
| msf | GCG MSF (multiple sequence file) format. |
| clustal | ClustalW ALN (alignment) format. |
| staden experiment | The experiment file format used by the "gap" program in the Staden package, where the sequence identifier is optional and the remainer is plain text. Some alternative nucleotide ambiguity codes are used and must be converted. |
| text plain raw | Plain text. EMBOSS will attempt to check that the text is likely to be sequence data rather than random "cut and paste" text by looking for some regularity in the layout. |
| unknown | Tries each format in turn until one succeeds. For all other formats, failure is fatal but EMBOSS tries to tolerate most format errors. |
The valid output sequence formats that are available in USAs are:
| Output Format | Comments |
|---|---|
| fasta | Standard Pearson FASTA format, but with the accession number included after the identifier if available. |
| embl | EMBL entry format with available fields filled in and others with no infomation omitted. The EMBOSS command line allows missing data such as accession numbers to be provided if they are not obtainable from the input sequence. |
| genbank | GENBANK entry format with available fields filled in and others with no infomation omitted. The EMBOSS command line allows missing data such as accession numbers to be provided if they are not obtainable from the input sequence. |
| ncbi | NCBI style FASTA format with the database name, entry name and accession number separated by pipe ("|") characters. |
| gcg | Wisconsin Package GCG 9.x format with the sequence type on the first line of the file. |
| asn1 | A subset of ASN.1 containing entry name, accession number, description and sequence, similar to the current ASN.1 output of readseq |
| fitch | Fitch format |
| ig | Intelligenetics format, as used by the Intelligenetics package |
| nbrf | NBRF (PIR) format, as used in the PIR database sequence files. |
| pearson | Simple Pearson FASTA format, an alias for "fasta" format. |
| phylip | PHYLIP non-interleaved format. This name may change in future |
| phylip3 | PHYLIP interleaved format. This name may change in future |
| staden | Staden package format |
| strider | DNA strider format |
| text | Plain text |
| trace | EMBOSS sequence object report showing all available fields. Not all fields will contain data - this depends very much on the input format used. |
As noted previously there are many 'associated' qualifiers that alter the behaviour of seqret when it reads in or writes out a sequence. As these are used in all EMBOSS programs that read in or write out sequences, they are not reported by the '-help' qualifier. They are however reported by the pair of qualifiers: '-help -verbose':
Some of the more useful associated qualifiers are:
| Qualifier | Description |
|---|---|
| -sbegin | The first position to be used in the sequence |
| -send | The last position to be used in the sequence |
| -sreverse | Use the reverse complement of a nucleic acid sequence |
| -sask | Ask the user for begin/end/reverse information |
| -slower | Convert the sequence to lower case |
| -supper | Convert the sequence to upper case |
| -sformat | Specify the input sequence format |
| -osformat | Specify the output sequence format |
| -ossingle | Write each entry into a separate file |
| -auto | Turn off prompts and don't report the one-line description |
| -stdout | Write the results to 'standard output' (the screen) |
| -filter | Read input from another program, write to the screen |
| -options | Prompt for optional qualifiers |
| -help | Display a table of the command-line options |
The set of associated qualifiers for sequences behave in different ways depending on where they appear.
If these qualifiers immediately follow a parameter they apply only to that parameter and not to all cases. If they occur before any parameters, they apply to all following sequence parameters.
If there are no two parameters of equal type, the order of parameters and their qualifiers is irrelevant.
Where a qualifier is defined more than once, for example "-sformat" for 2 input sequences to be aligned, the qualifier name can have a number to indicate which sequence is meant. "-sbegin2=25" will apply only to the second sequence, no matter where it appears on the command line.
The -sbegin and -send qualifiers take an integer number specifying the position to begin or end reading a sequence. If the number is positive, the number is the position counting from the first base or residue of the sequence. If the number is negative the position is counted from the end of the sequence, so position -1 is the last base or residue of the sequence. (If -sbegin 0 is used, it is assumed to be the same as -sbegin 1 and -send 0 is the same as -send -1.)
The filter qualifier makes the program behave like a filter, reading its (first) input 'file' from the standard input, and writing its (first) output 'file' to the standard output. The -filter qualifier will also invoke the -auto qualifier, so the user is never prompted for any missing values.
Example:
% cat sequence.seq | seqret -filter | lpr
The example shows the application seqret being run with the -filter qualifier. The input file is 'piped' into the program using the unix command cat and the output is 'piped' directly to the unix program lpr, which will print it on the printer.
When the -options qualifier is used and not all the parameters are given on the command line, it will query the user for those parameters. It will not only query the user for the required parameters as it would do without the -options qualifier, but it will also query the user for the optional parameters.
When the -stdout qualifier is used, the user will still be prompted for all the info that is required, but will write to standard output by default. The user will also still be prompted for an output filename, in case the user wants to save the output to a file.
% seqret Input sequence: embl:paamir Output sequence [paamir.fasta]:
Here seqret is used to display the contents of the sequence on the screen:
% seqret Reads and writes (returns) sequences Input sequence: embl:paamir Output sequence [paamir.fasta]: stdout
Here it is used in three different ways to write the result to a file in GCG format. Once by using the qualifier '-osformat', once by using the format in the output USA on the command line and once by specifying the format in the USA at the prompt.
% seqret -osf gcg Reads and writes (returns) sequences Input sequence: embl:paamir Output sequence [paamir.gcg]:
% seqret -outseq gcg::paamir.gcg Reads and writes (returns) sequences Input sequence: embl:paamir
% seqret Reads and writes (returns) sequences Input sequence: embl:paamir Output sequence [paamir.fasta]: gcg::paamir.gcg
Here seqret is used to produce the reverse-complement of a sequence:
% seqret -srev Reads and writes (returns) sequences Input sequence: embl:paamir Output sequence [paamir.fasta]:
Here seqret is used to extract the bases between the positions starting at 5 and ending at 25:
% seqret -sbegin 5 -send 25 Reads and writes (returns) sequences Input sequence: embl:paamir Output sequence [paamir.fasta]:
Here seqret is used to extract the bases between the positions starting at 5 and ending at 5 bases before the end of the sequence:
% seqret -sbegin 5 -send -5 Reads and writes (returns) sequences Input sequence: embl:paamir Output sequence [paamir.fasta]:
Here seqret is used to read all entries in the database 'tembl' that start with 'hs' and writes them to a file:
% seqret Reads and writes (returns) sequences Input sequence(s): embl:hs* Output sequence [hs989235.fasta]:
Here seqret is used to read all entries in the database 'tembl' that start with 'hs' and writes them to a file. In this example the specification is all done in the command line and to stop Unix getting confused by the '*' character, it has to have a backslash ('\') before it:
% seqret embl:hs\* hs989235.fasta Reads and writes (returns) sequences
Here seqret is used to read only the entry 'hsfau' from the file 'hs989235.fasta' which contains many entries:
% seqret Reads and writes (returns) sequences Input sequence(s): hs989235.fasta:hsfau Output sequence [hsfau.fasta]:
Here seqret is used to read all entries in the file 'hs989235.fasta', but only writes the first one of these entries out to a file:
% seqret -firstonly Reads and writes (returns) sequences Input sequence(s): hs989235.fasta Output sequence [hs989235.fasta]: first.fasta
Here seqret is used to display on the screen the short sequence "actgatcgtg" in uppercase in EMBL format:
% seqret -supper -osf embl asis::actgatcgtg stdout
Reads and writes (returns) sequences
ID standard; DNA; UNC; 10 BP.
SQ Sequence 10 BP; 2 A; 2 C; 3 G; 3 T; 0 other;
ACTGATCGTG 10
//
Mandatory qualifiers: [-sequence] seqall Sequence database USA [-outseq] seqoutall Output sequence(s) USA Optional qualifiers: (none) Advanced qualifiers: -firstonly bool Read one sequence and stop |
| Mandatory qualifiers | Allowed values | Default | |
|---|---|---|---|
| [-sequence] (Parameter 1) |
Sequence database USA | Readable sequence(s) | Required |
| [-outseq] (Parameter 2) |
Output sequence(s) USA | Writeable sequence(s) | <sequence>.format |
| Optional qualifiers | Allowed values | Default | |
| (none) | |||
| Advanced qualifiers | Allowed values | Default | |
| -firstonly | Read one sequence and stop | Yes/No | No |
The output from seqret is one or more sequences, and by default will be written in FASTA format.
If the '-firstonly' qualifier is used then only the first sequence of the input USA specification will be written out.
In some cases the output filename will be the same as the input filename, but as seqret reads only the first sequence before opening the output file it may try to overwrite the input. Note that this is not true of seqretset which reads all sequences into memory at startup, but which can need a large amount of memory for many sequences..
seqret is often one of the first programs taught in EMBOSS training courses. This is because it is versatile, it is extremely powerful for its size (17 lines of code) it illustrates many aspects of EMBOSS programs and it was one of the first EMBOSS programs to be written, so it has a special place in the hearts of EMBOSS developers.
The name 'seqret' derives both from its function ("sequence return") and from the fact that immense amounts of functionality can come from so few lines of source code - most of the work is done by the EMBOSS libraries which the program calls and whose complexity is hidden, or "secret".
| Program name | Description |
|---|---|
| remap | Display a sequence with restriction cut sites, translation etc |
| seqretall | Reads and writes (returns) a set of sequences one at a time |
| seqretset | Reads and writes (returns) a set of sequences all at once |
| seqretsplit | Reads and writes (returns) sequences |
| showfeat | Show features of a sequence |
| showseq | Display a sequence with features, translation etc |
Valid names of the databases set up in your local implementation of EMBOSS can be seen by using the program 'showdb'.